ID: 1176718830_1176718838

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1176718830 1176718838
Species Human (GRCh38) Human (GRCh38)
Location 21:10377321-10377343 21:10377366-10377388
Sequence CCTTGGCCTCCCAAAGTGTTGGG CTCGGCCAACCCTTGAATTTAGG
Strand - +
Off-target summary {0: 6346, 1: 95043, 2: 216067, 3: 233638, 4: 146425} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!