ID: 1176767663_1176767671

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1176767663 1176767671
Species Human (GRCh38) Human (GRCh38)
Location 21:13037120-13037142 21:13037164-13037186
Sequence CCTGGCGACTGCACAGTGCCCAG GGCGCGAGCCAAGGAAGAGCAGG
Strand - +
Off-target summary No data {0: 8, 1: 2, 2: 2, 3: 16, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!