ID: 1176975116_1176975120

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1176975116 1176975120
Species Human (GRCh38) Human (GRCh38)
Location 21:15312245-15312267 21:15312262-15312284
Sequence CCCTCCACGCTCTCTCTCTCCTG CTCCTGCTGCCTTGTAAAGAGGG
Strand - +
Off-target summary No data {0: 17, 1: 267, 2: 864, 3: 1458, 4: 2288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!