ID: 1177478154_1177478165

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1177478154 1177478165
Species Human (GRCh38) Human (GRCh38)
Location 21:21651070-21651092 21:21651116-21651138
Sequence CCCTGCTGGTACACAGAAGTGAC CCTACATTTCAGAGGATGTATGG
Strand - +
Off-target summary No data {0: 27, 1: 1330, 2: 2166, 3: 1582, 4: 915}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!