ID: 1177626372_1177626376

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1177626372 1177626376
Species Human (GRCh38) Human (GRCh38)
Location 21:23665692-23665714 21:23665740-23665762
Sequence CCCATATATGACAGGCTCAGAAT GGAGAAAGTAACAGTAGCAATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 18, 4: 132} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!