ID: 1177659159_1177659162

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1177659159 1177659162
Species Human (GRCh38) Human (GRCh38)
Location 21:24060473-24060495 21:24060512-24060534
Sequence CCTGAGACTGGGTAATTTAAAAA GACTCACAGCTCCCCACGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 12, 2: 238, 3: 4044, 4: 9501}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!