ID: 1177681220_1177681224

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1177681220 1177681224
Species Human (GRCh38) Human (GRCh38)
Location 21:24374140-24374162 21:24374167-24374189
Sequence CCAGTTTCCCTGTATACAAAATT GCTGATAACTGTTTTGTTTAAGG
Strand - +
Off-target summary No data {0: 6, 1: 193, 2: 533, 3: 406, 4: 472}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!