ID: 1177681220_1177681224 |
View in Genome Browser |
Spacer: 4 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1177681220 | 1177681224 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 21:24374140-24374162 | 21:24374167-24374189 |
Sequence | CCAGTTTCCCTGTATACAAAATT | GCTGATAACTGTTTTGTTTAAGG |
Strand | - | + |
Off-target summary | No data | {0: 6, 1: 193, 2: 533, 3: 406, 4: 472} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |