ID: 1177681220_1177681225

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1177681220 1177681225
Species Human (GRCh38) Human (GRCh38)
Location 21:24374140-24374162 21:24374170-24374192
Sequence CCAGTTTCCCTGTATACAAAATT GATAACTGTTTTGTTTAAGGAGG
Strand - +
Off-target summary No data {0: 4, 1: 189, 2: 528, 3: 397, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!