ID: 1177894573_1177894583

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1177894573 1177894583
Species Human (GRCh38) Human (GRCh38)
Location 21:26844549-26844571 21:26844601-26844623
Sequence CCGAGCTGGGATCGCCATTCACG GGTTTCCGGAAGCGGCGTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35} {0: 1, 1: 1, 2: 0, 3: 1, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!