ID: 1177902550_1177902556

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1177902550 1177902556
Species Human (GRCh38) Human (GRCh38)
Location 21:26934581-26934603 21:26934608-26934630
Sequence CCCTGGCGTACCACAGCACACCA CGAGCACAGACATCCATGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109} {0: 1, 1: 0, 2: 2, 3: 28, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!