ID: 1177902553_1177902560

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1177902553 1177902560
Species Human (GRCh38) Human (GRCh38)
Location 21:26934591-26934613 21:26934626-26934648
Sequence CCACAGCACACCACAGGCGAGCA CCGGGACACACGGAGTACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165} {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!