ID: 1177991371_1177991384

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1177991371 1177991384
Species Human (GRCh38) Human (GRCh38)
Location 21:28039557-28039579 21:28039602-28039624
Sequence CCCCTTAGGGGGGGCCAACTGGG AGAAGCAAACAGGGGTGTTGGGG
Strand - +
Off-target summary No data {0: 77, 1: 153, 2: 117, 3: 108, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!