ID: 1177991371_1177991385

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1177991371 1177991385
Species Human (GRCh38) Human (GRCh38)
Location 21:28039557-28039579 21:28039603-28039625
Sequence CCCCTTAGGGGGGGCCAACTGGG GAAGCAAACAGGGGTGTTGGGGG
Strand - +
Off-target summary No data {0: 72, 1: 124, 2: 116, 3: 85, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!