ID: 1177991371_1177991386

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1177991371 1177991386
Species Human (GRCh38) Human (GRCh38)
Location 21:28039557-28039579 21:28039606-28039628
Sequence CCCCTTAGGGGGGGCCAACTGGG GCAAACAGGGGTGTTGGGGGTGG
Strand - +
Off-target summary No data {0: 60, 1: 109, 2: 122, 3: 111, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!