ID: 1178012657_1178012661

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1178012657 1178012661
Species Human (GRCh38) Human (GRCh38)
Location 21:28305146-28305168 21:28305184-28305206
Sequence CCTGCCATCTTCTGCTGATAACT GACAGCTCTTGGCCTGCTACTGG
Strand - +
Off-target summary No data {0: 9, 1: 184, 2: 221, 3: 158, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!