ID: 1178094085_1178094089

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1178094085 1178094089
Species Human (GRCh38) Human (GRCh38)
Location 21:29195549-29195571 21:29195572-29195594
Sequence CCTGAGTCTTATTGATCCCTTAA CAGGTGCCAGACGCCGTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 125} {0: 1, 1: 0, 2: 7, 3: 109, 4: 1933}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!