ID: 1178625421_1178625424

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1178625421 1178625424
Species Human (GRCh38) Human (GRCh38)
Location 21:34213397-34213419 21:34213423-34213445
Sequence CCTCCTGAAGTACTGAGATTACA GTGAGCCACTATGCCCATTCTGG
Strand - +
Off-target summary {0: 7, 1: 223, 2: 4133, 3: 45828, 4: 362597} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!