ID: 1178632736_1178632737

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1178632736 1178632737
Species Human (GRCh38) Human (GRCh38)
Location 21:34276888-34276910 21:34276904-34276926
Sequence CCGATTCTCGTTGTGGTGGGGTC TGGGGTCATATGACTGTTGTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!