ID: 1178831454_1178831469

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1178831454 1178831469
Species Human (GRCh38) Human (GRCh38)
Location 21:36060325-36060347 21:36060370-36060392
Sequence CCCGGAAGTCCTACTAGCTCACC AGATGGAGGCTGCAGTGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136} {0: 1, 1: 9, 2: 154, 3: 1045, 4: 2381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!