ID: 1178942891_1178942896

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1178942891 1178942896
Species Human (GRCh38) Human (GRCh38)
Location 21:36922468-36922490 21:36922490-36922512
Sequence CCAAACTCGGCATGCTGTACCTG GGGGAGACGCAGCCATACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 68} {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!