ID: 1179109457_1179109462

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1179109457 1179109462
Species Human (GRCh38) Human (GRCh38)
Location 21:38433899-38433921 21:38433917-38433939
Sequence CCATCCTCCTTCCTAATCCTCTG CTCTGAATTCCTCTTGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 148, 4: 1984} {0: 1, 1: 0, 2: 1, 3: 26, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!