ID: 1179154483_1179154497

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1179154483 1179154497
Species Human (GRCh38) Human (GRCh38)
Location 21:38838257-38838279 21:38838300-38838322
Sequence CCATGCTCCAACTGTCTCTGCAG CATCAAGGAAGGCTCTCTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 124, 4: 574}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!