ID: 1179225065_1179225080

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1179225065 1179225080
Species Human (GRCh38) Human (GRCh38)
Location 21:39445775-39445797 21:39445804-39445826
Sequence CCCCATGGAAACCCGCGCGCGGG TGGGAAGCGCCGGCCTGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 25} {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!