ID: 1179708002_1179708004

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1179708002 1179708004
Species Human (GRCh38) Human (GRCh38)
Location 21:43193693-43193715 21:43193714-43193736
Sequence CCACGCTGCTGGTGAGCTGGGGC GCGGCCAGAACTCAGCACCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!