ID: 1179764835_1179764839

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1179764835 1179764839
Species Human (GRCh38) Human (GRCh38)
Location 21:43564407-43564429 21:43564425-43564447
Sequence CCCATGGCCTTGGGTAGCTCCAC TCCACCCCTGTGGCTTTGCAAGG
Strand - +
Off-target summary {0: 3, 1: 136, 2: 678, 3: 1178, 4: 1776} {0: 437, 1: 796, 2: 1347, 3: 1428, 4: 1389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!