ID: 1179764835_1179764847

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1179764835 1179764847
Species Human (GRCh38) Human (GRCh38)
Location 21:43564407-43564429 21:43564454-43564476
Sequence CCCATGGCCTTGGGTAGCTCCAC CCCTCTCCTGGCTGCTTTCATGG
Strand - +
Off-target summary {0: 3, 1: 136, 2: 678, 3: 1178, 4: 1776} {0: 30, 1: 166, 2: 534, 3: 723, 4: 977}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!