ID: 1179853573_1179853582

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1179853573 1179853582
Species Human (GRCh38) Human (GRCh38)
Location 21:44150902-44150924 21:44150923-44150945
Sequence CCCCATCTCTCCGGGACCCCGCT CTGCTCCCTGGGTCCAGCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!