ID: 1179990300_1179990308

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1179990300 1179990308
Species Human (GRCh38) Human (GRCh38)
Location 21:44944761-44944783 21:44944785-44944807
Sequence CCGGGTCTGGGGCCTGTAGATGG CCGTTAAGATCGTGGGCTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!