ID: 1179992986_1179992990

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1179992986 1179992990
Species Human (GRCh38) Human (GRCh38)
Location 21:44958293-44958315 21:44958308-44958330
Sequence CCCTTGCTTGAGGCCCAGCATCT CAGCATCTGCACTCCCAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 149} {0: 1, 1: 0, 2: 6, 3: 60, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!