ID: 1179992987_1179992993

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1179992987 1179992993
Species Human (GRCh38) Human (GRCh38)
Location 21:44958294-44958316 21:44958324-44958346
Sequence CCTTGCTTGAGGCCCAGCATCTG AGCCCGGCCCTCCTCCAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 242} {0: 1, 1: 0, 2: 1, 3: 20, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!