ID: 1180042581_1180042592

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1180042581 1180042592
Species Human (GRCh38) Human (GRCh38)
Location 21:45287835-45287857 21:45287875-45287897
Sequence CCCCCAGCAGCAGGAAGACGAAG CCCGGGCGGCCACGCACTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 393} {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!