ID: 1180297959_1180297971

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1180297959 1180297971
Species Human (GRCh38) Human (GRCh38)
Location 22:10961655-10961677 22:10961689-10961711
Sequence CCCGCCCGAGGCGCCGGTGCTGG CTGCCGGTCGCGCTGTGAAACGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 19, 4: 153} {0: 1, 1: 1, 2: 1, 3: 3, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!