ID: 1180297961_1180297973

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1180297961 1180297973
Species Human (GRCh38) Human (GRCh38)
Location 22:10961656-10961678 22:10961708-10961730
Sequence CCGCCCGAGGCGCCGGTGCTGGC ACGGCCTCCCGCTAGAGCTGCGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 0, 3: 4, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!