ID: 1180414295_1180414304

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1180414295 1180414304
Species Human (GRCh38) Human (GRCh38)
Location 22:12694029-12694051 22:12694067-12694089
Sequence CCAGGCTGGCCTGGAGCACAGGG TGGCTCACGAAAGCCCCCTGAGG
Strand - +
Off-target summary No data {0: 38, 1: 12, 2: 10, 3: 8, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!