ID: 1180414295_1180414305

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1180414295 1180414305
Species Human (GRCh38) Human (GRCh38)
Location 22:12694029-12694051 22:12694068-12694090
Sequence CCAGGCTGGCCTGGAGCACAGGG GGCTCACGAAAGCCCCCTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 38, 2: 10, 3: 18, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!