ID: 1180414295_1180414305 |
View in Genome Browser |
Spacer: 16 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1180414295 | 1180414305 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 22:12694029-12694051 | 22:12694068-12694090 |
Sequence | CCAGGCTGGCCTGGAGCACAGGG | GGCTCACGAAAGCCCCCTGAGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 38, 2: 10, 3: 18, 4: 74} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |