ID: 1180548970_1180548980

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1180548970 1180548980
Species Human (GRCh38) Human (GRCh38)
Location 22:16526991-16527013 22:16527042-16527064
Sequence CCGCCCAGCTGCTCCGTGCCAGG CACCATGACTTGCCTCACTGCGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 3, 3: 34, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!