ID: 1180548970_1180548981

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1180548970 1180548981
Species Human (GRCh38) Human (GRCh38)
Location 22:16526991-16527013 22:16527043-16527065
Sequence CCGCCCAGCTGCTCCGTGCCAGG ACCATGACTTGCCTCACTGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 2, 3: 22, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!