ID: 1180548970_1180548981 |
View in Genome Browser |
Spacer: 29 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1180548970 | 1180548981 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 22:16526991-16527013 | 22:16527043-16527065 |
Sequence | CCGCCCAGCTGCTCCGTGCCAGG | ACCATGACTTGCCTCACTGCGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 8, 2: 2, 3: 22, 4: 140} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |