ID: 1180821726_1180821742

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1180821726 1180821742
Species Human (GRCh38) Human (GRCh38)
Location 22:18833546-18833568 22:18833595-18833617
Sequence CCTAGCCGGGCGACGCCTCGGAG GCCCTTGGAAATCGGCGCGTGGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 0, 3: 4, 4: 48} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!