ID: 1180876720_1180876733

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1180876720 1180876733
Species Human (GRCh38) Human (GRCh38)
Location 22:19178303-19178325 22:19178341-19178363
Sequence CCCGTCCCGGACTTCGGTCGGCG TGCCGCGGGGAACATAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 16} {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!