ID: 1181020372_1181020376

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1181020372 1181020376
Species Human (GRCh38) Human (GRCh38)
Location 22:20098248-20098270 22:20098290-20098312
Sequence CCCAAATTGTTGAGATGACAGAC ATACTTCAGTTCTTTAGACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 206, 3: 4522, 4: 55467} {0: 1, 1: 1, 2: 5, 3: 33, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!