ID: 1181237479_1181237484

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1181237479 1181237484
Species Human (GRCh38) Human (GRCh38)
Location 22:21456405-21456427 22:21456440-21456462
Sequence CCTATTCATGTTCAGCTCCTCTT AACAATGAGTTGCCTCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!