ID: 1181507833_1181507843

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1181507833 1181507843
Species Human (GRCh38) Human (GRCh38)
Location 22:23373618-23373640 22:23373667-23373689
Sequence CCACGGACTCACCAAAGATGGTC CTCGATGTTCTTCTGGACCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 60} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!