ID: 1181527928_1181527940

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1181527928 1181527940
Species Human (GRCh38) Human (GRCh38)
Location 22:23500798-23500820 22:23500849-23500871
Sequence CCCTGAGCATCTCCCCCTGAAGG ACTCGCCTCTTAGGCAGCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 3, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!