ID: 1181568392_1181568399

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1181568392 1181568399
Species Human (GRCh38) Human (GRCh38)
Location 22:23753090-23753112 22:23753110-23753132
Sequence CCGTAGTCCCTGATGGTGACGTG GTGCTGGGGGCTGAGCGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53} {0: 1, 1: 0, 2: 4, 3: 57, 4: 574}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!