ID: 1181709612_1181709618

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1181709612 1181709618
Species Human (GRCh38) Human (GRCh38)
Location 22:24674220-24674242 22:24674271-24674293
Sequence CCTTCTCCAAGACACTGGAAGTG CTCTGTAATCTCTACCTGGAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 21, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!