ID: 1181709613_1181709618

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1181709613 1181709618
Species Human (GRCh38) Human (GRCh38)
Location 22:24674226-24674248 22:24674271-24674293
Sequence CCAAGACACTGGAAGTGCTGTGA CTCTGTAATCTCTACCTGGAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 27, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!