ID: 1181982734_1181982738

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1181982734 1181982738
Species Human (GRCh38) Human (GRCh38)
Location 22:26777348-26777370 22:26777380-26777402
Sequence CCTCTCTGACTCTGTTTCTTCAG GGGGATGTTTTAGATACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 167, 4: 966} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!