ID: 1182192539_1182192544

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1182192539 1182192544
Species Human (GRCh38) Human (GRCh38)
Location 22:28477782-28477804 22:28477804-28477826
Sequence CCACCTGCCCTCTCGTACAACTG GGTCTTTGTTCTTTCCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 135} {0: 1, 1: 1, 2: 1, 3: 33, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!