ID: 1182253865_1182253875

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1182253865 1182253875
Species Human (GRCh38) Human (GRCh38)
Location 22:29023841-29023863 22:29023894-29023916
Sequence CCCATGCCTGCCTGATAGCTGGG CAATTACCTGCTTATTTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 98, 4: 2023} {0: 1, 1: 0, 2: 0, 3: 16, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!