ID: 1182288123_1182288127

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1182288123 1182288127
Species Human (GRCh38) Human (GRCh38)
Location 22:29259959-29259981 22:29259972-29259994
Sequence CCACTGTGGCCCTCTTTAGACAG CTTTAGACAGAGTAGGAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 153} {0: 1, 1: 0, 2: 2, 3: 19, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!